EST 752257 is a singleton


Sequence

>752257 (1 EST) Length=442 GGTTGAACGATTCATTTTGGGTTGCTTTTTACGTTGCTGTTGCATTGAAGATGCTTTCGAAGAAAATTATCAAGAAAAGA GTTGCTCCTCCGCCGCCGATGATTACGATGTCGGAAACAGCAAAGATGGAACAAAATCCTCTTTGCCGTAAATTCAAAGT GACATATTGTTTTTGTTTTGGGAAAGCACGTCTTGGCCAAGTTGTTCATCCAAAGACTGCCTCTTGTATTGCTATCGTTG ATACTAATCCCGAGGATAAGGTAGCTTTATCGAAACTGAAGGACACAGTGATCACGAATTATAATGAACGCGCTGATGAG ATCCGGAAACATTGGGGAGGTGGTATTATGTCAGCCCGTTCACAGGCAAAGAAATCACGGATCGAAAAAGCTCGAGCTAA GGAACTCGCACAAAAAGCTTAAATGGCTTGCTTCATGTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 752257: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522571668241AA114371MBAFCE3A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:43:58 on Mon 20 Nov 117.