EST 752269 is a singleton


Sequence

>752269 (1 EST) Length=465 AAAAATTGAGGAAGGGCAATTATGCGGAGCGTGTTGGTGCTGGTGCTCCGGTATACTTGGCTGCGGTGCTCGAATATCTC GCTGCGGAAGTGTTAGAATTGGCACGCAATGCTGCGCGCGACAATAAGAAGAACCGGATTAACCCGCGACACTTACAGTT GGCAGTTCGTTTTTATTAACAATCGAACAAATTGTTGGCCGGCGTGACCATTTCTCAAGGTGGCGTACTACCCAACATCC AGGCTGTGCTTCTCCCAAAGAAGACTGCAGAGAATGCGTAAGGCTCATTTGCGCTACAAAACCCAACGGCCCTCTTTAGG GCCACAAATCTATGGATCATGCTGTACCCATGTAGGTCTANTTTGTGATGTTGAGTACTCTGGCGAGTGACTTGGTTTCA CTGGTTATGTCACTTTGGTACTGGGTCACCTCCGCTTCTACAATCAAGTCTGGGTGTTGTTATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 752269: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522691668253AA114422MBAFCE3B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:51:40 on Mon 20 Nov 117.