EST 752291 is a singleton


Sequence

>752291 (1 EST) Length=79 AAACAAGTCCCATGGTACATTTTTTGTTTGTGTTATATTAATGTAGTGCCTTAATTGCTGAATAAAGGTGACGTCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 752291: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522911668275AA114431MBAFCE3F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:56:5 on Sun 19 Nov 117.