EST 752322 is a singleton


Sequence

>752322 (1 EST) Length=130 CTCACTAAAGGGATTACCCTCACTAAAGGGATAACCCTCACTAAAGGGATAACCCTCACTAAAGGGATAACCCTCACTAA AGGGATAACCCTCACTAAAGGGATAACCCTCACTATAGGGATCACCCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 752322: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523221668306AA114410MBAFCE4E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 3:47:15 on Sat 18 Nov 117.