EST 752323 is a singleton


Sequence

>752323 (1 EST) Length=283 ATTCTTGTCATACATTTATTACCCATCCGATGCTTTACGTCAATTACGAGCAATTTGTTACGTGAGCACTTTTTCTTTTC GTATTTTATGAAAAATATTTCCATTAATTCAACAAACATTTACAATTCTCGGTAATATTTATTTATTTAATTAATTAATT TGTCATTGTTGTCGAAAATCTTTTTAAAATTATTTTACAATTTATGTTTTACAAGAAAATGAGCTATTTTTTTCTTTAAA AAGCCGAATTAATGAGAAAATAATTATTATATTATTGCAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 752323: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523231668307AA114411MBAFCE4E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:35:40 on Sat 25 Nov 117.