EST 752336 is a singleton


Sequence

>752336 (1 EST) Length=140 GATCCCCGGTACCGAGCTCGAATTCGTAATCATGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCAC ACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 752336: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523361668320AA114476MBAFCE4H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:33:29 on Tue 21 Nov 117.