EST 752349 is a singleton


Sequence

>752349 (1 EST) Length=149 CTTTGCAAATCTTGTTTATTCTGCGAGGTGATTTCAGGATGGTACTATGTTGGCGGGGAAGTTTTTAACAACCTTTCGGT ATAAAACTATTCTGGAATATTCATCACGCCCATCCACGATTTCTTAACAAGATCGTTCTCGTCGTTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 752349: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523491668333AA114462MBAFCE5B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:4:17 on Fri 17 Nov 117.