EST 752374 is a singleton


Sequence

>752374 (1 EST) Length=289 GGTGACCTTGCGAAGGTACCACGAGCAGTGTGTATGTTATCAAATACGACAGCAATAGCTGAGGCATGGGCAAGACTTGA TCATAAGTTCGATTTAATGTATGCTAAAAGAGCTTTCGTACATTGGTACGTTGGTGAAGGAATGGAAGAAGGTGAATTCT CAGAGGCACGTGAAGATCTTGCGGCTTTATAAAAAGACTACGAAGAGGTTGGTGTTGATTCAATGGAAGATGCTGGTGAA GAAGGAGATGAGTATTGACATAGATGGGAAATGGCAATTGAAATTTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 752374: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523741668358AA114448MBAFCE5F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:51:45 on Sat 18 Nov 117.