EST 752388 is a singleton


Sequence

>752388 (1 EST) Length=87 TCGAAATTTGTGTTATTGGTGCTCATAAAAGAAGTAAGGAAGGATTGTTGTATTTCGGTTTGACCTTGTGCTTATTTCAA TTCAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 752388: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523881668372AA114524MBAFCE5G11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:20:50 on Wed 22 Nov 117.