EST 752408 is a singleton


Sequence

>752408 (1 EST) Length=440 CGTTAGAGACAGTTTCCTTGATGATTATTTCCCGAATCACTTTCCAAAGCTTGTAAAATGGTTCATTAGGATGCGAACTA TGCCAGAGACCCAAGTAGTTCGAGAACCAGAACACCACTTGAAGGCATTCCTGATCAGCAAAGCAAAACAAAATGCTACT GATTTCGATATCCATCTCTCTGGTTCTAACATACCAATTAATCGGAAATTTCTCAACGATTCAACCGTTCAATGGCACAA CAATTAAATCTAAACATTAAATGCAGAAAACCAAAACAAAGAGTAACTAATGTAAAGAGTATCATTGCGGACGGAGAAGC TAATTATTTCTATCTCCATCTTCTCTTTTTCATTTTTTTAATATGCGAAATATTTGGTGCATCCATTGAACACTTATTTA TATCAGGAACTGAAATCATAAATAATAAAGGTATGACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 752408: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7524081668392AA114496MBAFCE6B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:48:17 on Thu 23 Nov 117.