EST 756667 is a singleton


Sequence

>756667 (1 EST) Length=141 TAGCAGCATTCATCATTAATCCTGAATATGACTGAAATTCCACAGGTAACCGCGCTCTAGAGACCTGCTGTCAGTCAGTC CTTCTTCTGTATCTTATGATCGATCATCGATCCGCTTCATCGGTCAGTCAGTATAACTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 756667: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7566671675184AA118243KJ4SLB79T3JHU93SL-BmL4 (JHU)


Date: 20:52:46 on Thu 23 Nov 117.