EST 756668 is a singleton


Sequence

>756668 (1 EST) Length=222 GAGTCTNNTATTACNNAGTTAGATTAACCATTGGCAAATTTTTTGTCAAAAACTTTAACCTGGTAAAACGATTACGCTTA GGTCGAATCCTCAGATACAATTGAGAATGTAAAGCAAAATACAGGACAAAGAAGGCATACCTCAGATCAGCAGCGTTGAT TTCAAGGTAGCACTGGAGACGGACGTACTCTTCGACTACATATCAAGATCACACTCATTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 756668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7566681675185AA118244KJ4SLB104T3JHU93SL-BmL4 (JHU)


Date: 4:16:0 on Fri 24 Nov 117.