EST 756672 is a singleton


Sequence

>756672 (1 EST) Length=176 AATACCAGTTTAGGAGTAAAAATAACTTAACAAGCTAGAAGGTAAATGGAGGCGATGATTGCGATAAGAGCAGATGGATG ATTAGATTGGAACGGACCCGAAGATGATACTAAAGATCAAGCTAAGAGGGATCGAGAAAAGATCCAGGTCATTGAAGGAT GATAAGAGGACGATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 756672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7566721675189AA118248KJ4SLB134T3JHU93SL-BmL4 (JHU)


Date: 15:53:32 on Fri 17 Nov 117.