EST 761956 is a singleton


Sequence

>761956 (1 EST) Length=471 GAGAGCTTACTAAGTGGTGGTGACGCTAGGAACAGATGGTTCGACAAATGCTTCCAATTAATAGTTGATGCACAAGGTAC AGCTGCGATAAATTTTGAACATAGCTGGGGTGATGGTGTTGCTGTACTTCGTTTAATGGAAGAATCATTCCGTGATGCGA AACAAAATCATTTTGTACATCCGAAAGAAACCTTCAATGCCACAGCATATTTAGGAAGTCATTTACGACCAATTGACTTC ATATTGACTGATTCAGTACGTCAAAAGATTCAGGAAGCTCAAGCAAAACATGTTGCGATCGGATCCAGAATATGTTACAG TTCTGCAGAATATTTTGATCTAAACCGACAAACTATCAAACGATCAAAGCTTTCACCGGACTCTGTTATACAATTAGCAA TCCAGCTGACTTTTTATAAGCTCTTTAAGGAATTCGTTCCATCTTACGAATCTTGCAGTACTGCAGCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 761956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619561681824AA123653MBAFCE7B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:14:5 on Thu 23 Nov 117.