EST 761957 is a singleton


Sequence

>761957 (1 EST) Length=450 GGATTACGTTAACTATAAACGTTTCATTAGAAATGCTTTAAGAAACAAAACTTACTTACCGACATACAGTGGTTTTGGTG CAGGAGCGGTACTTATGTTAATCTACATGACTAATTGGGAAACTGTTGGACGTCGTATACCTATTTGGAAATATCACTTC GAACCAATATCTATCGAGAATAATAATCCCACGAATGCTACGTCGACGTAACTACTTGCTAAAAAATTATCTGTATTAGT CTGTTAGAAATTTCCCCCAGAACTAGTTTCTGTGGTTAAAGTAGATCTTTTTCGCTTCTGTTAACGAAGATTTTTCATTG TTATTTTGATGAATTTCTTCCACTATGTTTTAAGGAGTTTGAAGTCTTTTTCATAGCAAAATTCTTATAATTTTAAGAAG GAATGTTTTATAAAATCATTCTCGGAAAATAAAGGTCCAGCATTGCTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 761957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619571681825AA123654MBAFCE7B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:1:11 on Wed 22 Nov 117.