EST 761974 is a singleton


Sequence

>761974 (1 EST) Length=177 CCTTTGGTTAAACTTTTTCTTGTTTGATATTTTCATTTATAATTTTTGTGTGTTTCATATTTCGCTTGCTAAAATCTATT TTTGTAAGTTTTAATATTTAAAATTCTTGTCCAGATGGAGTTGTATGTTTGGGATTCTTTTGTGAATTATGCAAAGTTTT AACCATTCCTTACAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 761974: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619741681842AA123518MBAFCE7E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:20:34 on Fri 24 Nov 117.