EST 761975 is a singleton


Sequence

>761975 (1 EST) Length=225 GTTTTATAAAATTAGGTATCGCCGCTAACAATTTCTGCCACAGTTATACTAACTGGTATTCATTATTTCTACTTTCTTTC TGAAATGTCTCCTGTTGGATCTTCGGCATAAAGAAAGAATGGACAGCAATTCTTTTGTCCTAAAATAAATTCCTTACAAT TATAACTTCTTTTTTTTGCTAATTATTACAATGAATGTTTTTTATATTGAATAAATTTTTGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 761975: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619751681843AA123519MBAFCE7E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:49:41 on Sat 18 Nov 117.