EST 761979 is a singleton


Sequence

>761979 (1 EST) Length=373 GTCCATGAAATATCCTGGAGTTCCGAGTGGTTTTCGATCTTCACAGCCTTTTAAAGCTGTTCATTTTGATCTAACAACAA AGGATAATGAGTGGGAATATGGCTCATCTAAACAGGCATCGTTCTGCGAAGTGTTAACACCAAATATACATCCTTCATTT NTGGTATTTTCAAGCATATGTGAAACAAAGCATATTGGTGGTGTTGATGCTGTCTGCGTTACATTGTGCAGAGTTTTATA CAATTCTTATCAGATTACGTTGTACCACCAAATCAAGTCATGTCGCGTGATCTCGAGCAGTCTGTTCGGCAACAGTTAAA CTGTATGACGGAGAATGGAAAGCATTCGTCTCCACTGATGCTGGGCAATCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 761979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619791681847AA123523MBAFCE7E07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:36:26 on Tue 21 Nov 117.