EST 762013 is a singleton


Sequence

>762013 (1 EST) Length=346 CAAAAGCAATGAATATGTTAGGAACAGCGGAAGAGCAATGTCGACAACTGGAAGCCAAAATGGAGCAGTTGATGAATGAT AAAGCGAAATTGCTAGATGCAATTGAAAAATTGGATATCAAAAAGAAAAATGAAATTATTAAAGCTCATGAAAAAGTAAA TCGAGACTTTGGTAACATTTTTTCTACGTTACTGCCTGGTACAAGTGCAAAACTGGAACCTCCTTCAGGTGCCACTTCCG CGTTAGGTGGTTTGGAAGTAAAAGTTGCTTTCAGAAACAAATGGAAAGATTCNCTTGGCGAATTGAGTGGTGGTCAGCGT TCTTTAGTAGCCTTATCGCTAGTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 762013: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620131681881AA123570MBAFCE8A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:44:32 on Wed 22 Nov 117.