EST 762031 is a singleton


Sequence

>762031 (1 EST) Length=502 GTTACTCTTTGCGAATTAATCATTTCGTTTCCTCGGCGATGTTGATTTACAGAGAATTTATAGATTGATATGGAATGTAG TTTATCTTCAATTTCATTTTATTTTTTTTAGTTTGCGTTATGGAGTTTTTTTTACTTCAGTATCTGCGGTGGAGCAGTGA ACTCAAGCGGCCGATATTTCTGAAACGTCTTTATTAGGCGAATTGAAACTCAGAAGTTGTTTTTTTCAGATTCTGATAAT ATAGGATTATAGCATTTCAGATAATTTTTCACGTATGAAAAAAATTAAATTAAAATTCTCAGCCACAACATTTAATATAT TCAGAATTATATTTCATAGAAATCTTTGTGCATAATTTTGAGCGGCTTTTTGTTAAGCTTTTTGAAAAGTTGGTAGCTAT CACACTTTTTCATCTTTTATAACTTGTTTCATACAGTTTTGATGTGTTTTTAATCATTTGTCCGTTAAAAAATGCGAGCT GCTAACCTATTTTTTTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 762031: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620311681899AA123588MBAFCE8C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:38:27 on Fri 17 Nov 117.