EST 762037 is a singleton


Sequence

>762037 (1 EST) Length=426 CTGAAAAATTTCATGGATAAACAATCAACAAGTAGTGTTGACAATACTACTACTACTACTGCCACTACGGTTACTACTAC TACTGCTATTACTGCCACTAATTTGATGTATACTGTTAGTAATGTAAGACCAAAAATTCGTCAGTGGTCATTGGATGATT TTGAAATTGGTCGAACATTGGGTTAAGGTATATTTGGGAATGTGTATTTGGCTCGAAAAATTGAATCAAGGTTTGTGGTT GCTCTTAAAGTTGTATACAAATCACTATTGGAGCAAAATAATTTGAGACGACNATTACGACGCGAAATTGANATTCAGTA TCACTTAAGACATCCCAATATTCTTCGGTTATATGGTTATTTTCACGACGATGATCGCGTTTATTTGGTGTTAGAATTTG CGCCTANAAGAAATCTGTTCCAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 762037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620371681905AA123594MBAFCE8D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:43:41 on Fri 17 Nov 117.