EST 762047 is a singleton


Sequence

>762047 (1 EST) Length=421 AAGACTTGGAGCACTTATAACAAAACAGGGAAGAATGTTGAATTACNCTGGTCGAAAGCCATCGGCATCTGCAGCAACGG GTAACAAATATACTCATTACGTCGAGCTGAAAACCCTTCTGGCAGACGCTCTGCATGCTCGAAAAGCTGATCTCGACGAA TTCATAGGTGGATAGTGAAGTGTGAGTGTTCGATTACTGGTCANACTCTGACTTATTTATATTCTTTTAGTCGTTTCTTC TCGAGGATATTAGCTGAAGAAAGCACGAGATATTCATTTGCAATCGAATTGTATAACTTAGTTGTTCAGTGAACTCAGGT AATTGATGTATTTCTTTGAAAATATCCGTCAGCTAACTACAGTAGTTTCCATATTGTAGGATGCTTTGCATATTGCTGAA TTTTTTCTCTGCAGAAAAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 762047: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620471681915AA123624MBAFCE8D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:44:48 on Sun 19 Nov 117.