EST 762051 is a singleton


Sequence

>762051 (1 EST) Length=390 TGGAGCGACATATGCAATTAGTGAAAAATTTGGAACGAATTAAGAAGGAATATGAATTTTTGGAATTACAGAATGAAGCA TTGAATGCAAAACTTGATTCGAAGGAAGCAACCATTCGAGATCTCGAGGATAGCATTCATACGATGAAAATGGATGCATC TCGTAAAATGGAAAGTGGTTCGGTGACACCAAAAGCAGATGCTTTCTCTGTATTTGATATTGAACCAACGAAATTTCTAA GCAATTCAAAGGATTCAAATACGAAAAGCGATCGATCCTTGCATCCATCATCACCATCCGGTTTAGAATCATCAAAACGA GTGGACAAATCATCATCTGTAATATTATCTGATTCGGAAAATGATGACAAAATTCAACTTTCTGCATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762051: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620511681919AA123628MBAFCE8E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:16:40 on Thu 23 Nov 117.