EST 762060 is a singleton


Sequence

>762060 (1 EST) Length=396 GTTTTCTGGAATGGAATATACTATGTGTCGCCGAACAACACGCCTCACAAATGAAAAAGATTCTGACAGTGAGGAAGATG CAGTTTGGGGACTTCCCTTCAGTTTAGCAATGTTTGATTTCAAACAGTGTGATCCGAAGCGATGTACAGGAAAAAAGCTA TTGCGTTATGGCTTTACCAAAGTTTTAAAGCTGGGAACCAAATTTCCTGGTTTGCTGCTTTCTCCAGGTGGTGAACGAAC AATTTCTCCTGCTGATCTCGTTTACATTAAAACTGGCGGCCTTGCTGTTGTGGACTGCAGTTGGAATCAGGTTGGGAATG TTGATTTAAGCAGAGCAAAAGCTTCGCACCGTCGTCTTCTGCCGTACTTAGTTGCTGCTTATCCGGTGAATTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620601681928AA123526MBAFCE9A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:57:7 on Wed 22 Nov 117.