EST 762065 is a singleton


Sequence

>762065 (1 EST) Length=72 CTCGAACGGCTTANCCACTATTAGTGAATCTTAGTGTTTGGCACATATCTGGCATTTGTAAAATTTATGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762065: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620651681933AA123531MBAFCE9B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:19:14 on Mon 20 Nov 117.