EST 762076 is a singleton


Sequence

>762076 (1 EST) Length=189 GTGGTTATAGCAGTGGAAGAAACCTTGAAAGACCTCACATGAAACGAAATGAGGATAGTTAATATCACTTATATGAGCAT AGTTACTGTATGCTTTGCTAGATTTAGTCAAGTTAACCTTTGTATAAGATGCGTGTATCAAAAGTAAGCTTAGTGCTCAT TTATTTAGTGTAAATGAATTTTGTCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620761681944AA123607MBAFCE9C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:24:45 on Wed 22 Nov 117.