EST 762081 is a singleton


Sequence

>762081 (1 EST) Length=390 CAGGTCAGAAATGAAGCAGCCACACCAGAATCTTTTTGGGTTGCATACCTATTTCATTATTTATTTTATCATAAACCATG AACATAGCATTAAAATATCGTCCTGGTAGCTTTAAAGATCTAGTAGGTCAAGATATACTAGTGCGTATATTAGAAAACGC TTTTACTCTCAACAGAATTCCACAATCTATACTGCTTTCAGGTGCTAGTGGGGTAGGTAAAACTACCACAGCAAGAATAA TAGCCTTATGTTTAAATTGTTCCTTGGGACCGACTTTTGAACCGTGTGGGTCATGTAAAAATTGCCTGACGATAAAAAAT TCAAGCCATCCAGATGTAATTGAAATCGATGCAGCAAGTCATACTAGTGTTGATGATATCAAAGTAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762081: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620811681949AA123612MBAFCE9C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:53:22 on Sun 19 Nov 117.