EST 762084 is a singleton


Sequence

>762084 (1 EST) Length=392 CGCCAGCAAAAAAGAAAATAAAACTTTCAAAGGAATTCAATCCGTTGGATGCAACTCCTGTTCATCCAGAAAGCTATCAA ATTGCTAAACAAATACTGGAATATGCTGGTGCCGATTTGACACATATTGGGCAGAATAATCTCTACCAAATGTCAGCAGT GATCGAAGAACGAATTAGGGAACGAGGTCCAGAATGGCTTTCAGTATGGGAATTACTTTCAAATCCGTTTGTAAGGAAAA ATGCGCCAGTACTTTTGACGAATGTACTGGAAATGAAATCACTGAAAGTTGGTGATATCTTGGAAGGTGTTGTTCGAAAT CATGCTAATTTTGGTATATTTATCGATATTGGGGTAGGCTTCAATGCGTTAGCACATTCATCAACTCTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620841681952AA123615MBAFCE9D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 3:54:27 on Sun 19 Nov 117.