EST 762090 is a singleton


Sequence

>762090 (1 EST) Length=148 ATTTTTTTTTCCTTTGGTCATTGTTTTCAAACTTTCAAAGTCAATCATAATTACCCTTGATTGGCTATGCTTTTCAAAAA CGTTTATCTCCCCCGTGTGACATTAGTGTTTATCTGGTCTCCACCCATTTCAAAGTAGTGTGCCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762090: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620901681958AA123621MBAFCE9D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:25:29 on Sun 19 Nov 117.