EST 762110 is a singleton


Sequence

>762110 (1 EST) Length=485 GTTTGAGCTGCCTGACCGATCAATTGGTTGATTGATTTGGATGGACGAATGATTTACTAATTCATTTAATAAATGAATGG ATAAGTGATCAGCGGAATGTGTGATCAAAAAACGATAGCTTACACTTCGGTTCCGGGAGATATTTATGAAATTGTTGGAA AATTAATGTTTGCCTACGGTGATGAAGCTGAACCAATTGAAATTTTATGCGACCAAGAAACGAAATCTCACACATAACTA TTTCAATTCTCAATGCGACTATATAATTGTTTTATGTCAAAAATACGTCATCGATATTTTACGTAATCAGATGATAGATA CAGTAAATAGAGCCAAGAAATGTTGCAGCATTAAGAGGCTGTAAAAGAATCGAATGTTATTGATTTATTATTTCTTTTAC GCCAAAAAACCTTTTCATCTTGGTCGCATTTATCCGTATACTNAATCAGCTGATTTATTAAAGGTTCCGAAGAAGATTAT GAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 762110: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7621101681978AA123683SW3ICA1912SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 1:18:54 on Mon 20 Nov 117.