EST 764116 is a singleton


Sequence

>764116 (1 EST) Length=387 GCAAATGGGGTTTTTTAGTTAGTGGATAAAGAGACGAAGTGAAGATGAATAATATAAATAAATAAATAATGATAGGATAA TAGGAAAAATTAGTTAATTAATTAGTTATGGTATTAATATTTCAAATACTTCTGGAATATTTGAGATATTTTGAAAAGTA ATATCAGTTAAGCAATCAATCAGATGTGATATTTGTAATGTATGTTTATACTTTTTTTTCTACTCTTTAACTTCTTCAGT AACTAATTTTGCTACTTTTTTTTCGAACATTTCATATCATTCGACGGGTATTATGGCATTTTTCCCGAACAAAACGATGA AATCTATAATTTGTTCATTAAAAAAAAAAAAATTTTGAANTGAATAAAAAAAATTTTGCAAATGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764116: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641161685432AA125654SW3ICA1921SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:34:36 on Sun 19 Nov 117.