EST 764130 is a singleton


Sequence

>764130 (1 EST) Length=295 TTCCAGCTCCTTTGCAAATTGCCAGTGGCAAAGGTTTGCCGCTGGGATAACGAAAAACAACACATTGATGATTAAGCAGA TCATGAGGATGGCGGGGTTTGCCATATCTTGCAAAGTACTCTGGCGTTGCTGCTACACATAATTTCACTGGCGGGCCGAT CGCCACGCTGATCATATCTTTTTCGACGATGCAACTAAGTCGAACGCCAGCGTCAAAGCCCTGTTGGACGATATCGACAA GAGAGTCGTCAGTTGTGAGCTCGACTTTAATATCAGGATATTCACGTGTGAAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764130: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641301685446AA125694MLLG0102.M1FSchistosoma mansoni, lung stage


Date: 16:20:4 on Fri 17 Nov 117.