EST 764132 is a singleton


Sequence

>764132 (1 EST) Length=372 CATTGGAAGGTATATAACTGTATTTTAAACATATCATATATATATCACCATAATAGTAACTAACTTATCAACTCAAAATA TCATAGATTATTTTTTTCAAAAAAAAAGAAATGAAAATGAGAAAATCAAAAAAATAGACTTTTTTTATTTTAAAAAAAAA CACAATAATGAATGAACCAATGACTGGAGAGAAATTCCTTGAACGATATAAAAAGGATAATAAAGAAAAAGGCGGGAGGG GGAAGGAAAATTATGATGAATGAATAGAAGTCAAACGGATTCCAAATGAAATTGTATAATTCCCNCNCTTTTCAACTGGA TCACCTACAGTTGAACGTTTATATATAACCTTATGAAATTTAGATATTATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764132: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641321685448AA125696MLLG0105.M1FSchistosoma mansoni, lung stage


Date: 19:2:19 on Sun 19 Nov 117.