EST 764135 is a singleton


Sequence

>764135 (1 EST) Length=316 AAATATTTACTTTAAAAACATTGAGGTCCCCAAAATCCTGCTTGGCATCCGGACAGTTCACATCTTGTACCATGACGACC TAGAGGACATTGACAAACCCCAGTTACGGNATCACAGTCGACATCATTTGCACAGTCACAGTACTGTTTGCAGTCCACAC CCCATAGTCCCTTTGGACATTTTTCTTCACAGATAATTCCTTTATAACCAGATGAACATTCACATCCAGTTAAATCTCGA TTACATCGACCACCATTTTCACAATGTGAACATGTAAAACTACAATCATGTCCAAATCGTCCAGGTAAACATAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641351685451AA125699MLLG0111.M1FSchistosoma mansoni, lung stage


Date: 22:14:33 on Sat 18 Nov 117.