EST 764136 is a singleton


Sequence

>764136 (1 EST) Length=343 GTTGTTGTTGCTGTTGTCAAGTGAATATTATGTAATAAAAAAAAAGCCCGAATCTAATCTAGTTCAATGAGAAAGAACTT AGCCATAACGACTAATAATAATAATGATCAATCAAAACGAGCATGTATTCACAATAATAATAATGATAATTAAATAACAG TAGAAAATTATGTAATCAATATTAGTAGANNACAAAAAAAATTTTTTTAAAAAAAACCCAACAAACAAACAAATGTGAAT ATATCCATAGATACACACACACGCGCGCGCATACATACACACACGCACCTAAAAAATAACATCTTGATCAAGTTGATAAT AAAGAATGAATATAGGTGATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764136: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641361685452AA125700MLLG0114MFSchistosoma mansoni, lung stage


Date: 18:48:2 on Thu 23 Nov 117.