EST 764138 is a singleton


Sequence

>764138 (1 EST) Length=302 ATAGCTGCTTAACTGCCTTCTCCTTTCAAGCTTTCTGTATACGATGAATACAGAAGATTAGTCGTGAGAAAAGAGCCTTC AGTCTGCTAAACTATATGTACGCACTTAGTGCTCCTTTCGTTTAAATTTTATATGATAGTTTAAGTGTTTGTACAGTTAA ACAGATTTTACTTTTGCTCATTTGTATTGATTAGTACGTTTGGGGGTTTTCCGACATTTCACACTATAGTTCCTTTTCAT CTAATTAATCACAAGTTCCTTTTTTGAATTTAATTTATAACGTGAGTTTTTTGTCGTTATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764138: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641381685454AA125702MLLG0116.M1FSchistosoma mansoni, lung stage


Date: 4:39:16 on Sat 25 Nov 117.