EST 764142 is a singleton


Sequence

>764142 (1 EST) Length=300 TTTGGAGCCAGGCTCCAAGGCAACAGAGGGAGGTGGGGAGGCTTTGTCAGGTGGTCCTGAATGTGAGGTGCCTCTTATGG GCTACCCAGGGCCCAGCCTTCAGGGGGTCCTCCCTGCTAAGCACTACATTTAGACTGGTGAGAAAGAGCAGCCAGGGGGT CAGGCTTTCAGTCACCACCCTCCTGCTGCCACAGAAGGAAGTTCTCAGTATACACCACAGTGCACGTGCATGATGGAGCT GTGGGACCCTCTCTGGGCTGGGTCTCATCTGTAAGCTGCTACAGCCCAGATGAACTCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764142: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641421685458AA125706MLLG0124.M1FSchistosoma mansoni, lung stage


Date: 21:46:55 on Fri 17 Nov 117.