EST 764143 is a singleton


Sequence

>764143 (1 EST) Length=326 CGGAGACATTTTATATGTTCATTATTAGAAACATGTACATTAGGCCTCTCTTGTTTGGATGGGTAATCTGAATTTTTCAA CCAAGTACTTTAGTCCATAGGATTCTTCTCCGATATCGGTTACTACAATACATGAGGCTGACACGACTTTTCTAGCCTTT CCTTCTTTGTCATACTTACACAATCCAGACCACTCACCAAGCTTTTTATTATCGGGAACCTTCACAAGAGGGATACCATG TTCGTGGCATAGTGCTTCAATCAGAGTTGTATAGGCTTTTCGTTACAATTTCTGCCAGAAAACAAAGGACAACACCCCGT TGTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764143: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641431685459AA125707MLLG0127.M1FSchistosoma mansoni, lung stage


Date: 0:34:17 on Thu 23 Nov 117.