EST 764147 is a singleton


Sequence

>764147 (1 EST) Length=440 AATATCAACCCAACTGTCTGCCCGCGTTGCGCCTGTTTGCGCAGAAAGAGCATAGAAACGCTCTTTTTCACTCAGCAGAT GTTTAGCGACCGCTTTAAGCATCGCCGCACGTTCGATAAAGGTCATAGCGCGAAGGGCGGGGGCACCTTTTTCAATGGCA AACTGGCGGGCAGCCGCATATCAAGACCTTCACTGGTCACTTCCCATAACGCCTCGCCGCTAATAGCGTGGTGAATCAAA CGGCTACGGCCCCGGCCAGACTGCCAGGTACCGGATAAGAAACTGGCTAACTGCTGCATCGCTACTCTCCAGATGTTTCA CATTTCTGTTGCTAATAGTTAAATCGCGAATCATAAAAAGCAAAGGATCTTTTAACGAAATGTTAACTATGCGATCTGTA TAGCAACTGCGGAAAACATTAATGCACTGATAAATAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764147: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641471685463AA125711MLLG0133.M1FSchistosoma mansoni, lung stage


Date: 16:17:42 on Sat 18 Nov 117.