EST 764148 is a singleton


Sequence

>764148 (1 EST) Length=443 ATTACAGTGAGGTTATATTTTAACGTTTGTTAAAGGGTCTTCTGATGCAACTGCAGAAGCTTCATTTAAAGGGACCCACG GTTTATTTGAATCTAGAACACAACGGAACATCAGTGGACCACGTTCAAACCAACGTAGTGAGTTAGAGCAGTGAAACCTT ATGCGGTGCACAGCAATCTGACCTTCAAAGTATGTTGCAGGTTCTTGCTCAGGTGTTGTGGACTTAGCTCGCATTTCTTC AGATGTGATTTGCGCATTCACAAAAGCTGGGCGGACGTACAGGAAAGGATTTATAATTAGATAACCCCTTTCCGGGTTGA ATACGTTAGTTATTTCATCTGAATCTACACATTCTAGGCGTAAAAGTCTTAACACAGGAACAGGCCCACGTGCTTTCCAA CTTATACGAGCTGGGTTTATTTGGNTGGNTTTAAAACTGAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764148: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641481685464AA125712MLLG0135.M1FSchistosoma mansoni, lung stage


Date: 8:51:15 on Mon 20 Nov 117.