EST 764149 is a singleton


Sequence

>764149 (1 EST) Length=398 CACTAATTAATTTATTTATTTTAAAATGCCAGTCACATAACTCGGATCTGTAAACAATTTTAATGCCATAAATGGATAAC ACCAAACCACTTTATGACAAGTTCACTATACAACAATCAAAAAATTAACGGAGACAAAAACTATAGTAATAAGTTTATAT TCCTTCTCTTATCGATTGTATGATTGCAGTACACCATTTTCGTTGTTATTTGATCTCTGTAACATCTGTGAATGAGGTAG GATCAAATGATTTATCTAGCATAAAAGATGTAATCAAGTTGGTCACTGTATTTGGAGCATCAAAATGAACCCAATGACCA GTGTTAGCTATTTGAACAATTTTGATTGAGGGAAATACTTGCGTACAGCTGGTAAATCNGATTGNCCNAAATACTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641491685465AA125713MLLG0136.M1FSchistosoma mansoni, lung stage


Date: 19:20:13 on Fri 24 Nov 117.