EST 764155 is a singleton


Sequence

>764155 (1 EST) Length=337 GAACGTATTATATTGGCTTTATTTTGAAGTGCNATCCAATCAGCGAGAACACCAGACACTTGAGGTCCTGAACTAAGTAG TAATATGTTCTTAATCCCTCAGGATCCTTGCTATTCGTAATATCAATCAGGGATCCTATTTTTGAAGTTGTGAAAGATAT GTGTTCATCGCCACAAACAATTTCGAGCTCTTGACGGCCAACTCTGTCAGGTACTGGCCATGAAGCATCATCTTCCGACA TAATATCGCTCTCCAACACGATTCTCTTCAGCTCTTCCACTACAGAGGGGGCTAACATACGCCTCTTTGCGAATCATTGT GTCATTTTTATAATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764155: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641551685471AA125719MLLG0150M1FSchistosoma mansoni, lung stage


Date: 23:11:23 on Mon 20 Nov 117.