EST 764157 is a singleton


Sequence

>764157 (1 EST) Length=250 CCAAATATAATAATAAATAACGTTTNGCAACTNGAATCTTGAATAGTGTAAATCATATATAATAAGTGAAGCAATAAAAG TAATAATAATAAACACTAGTCTGGGTTATACTCTTCGTTTATTAATTGTTCGCGGCGAATACGATCGAATTCTTTTACAC GTTGACGATTTGCATGGGCCCGCTGACGACGACCATAATCAAACAAAGTTGAATCGTTCCGTTCATATGATTTAGATGAT GACATCGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764157: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641571685473AA125721MLLG0154.M1FSchistosoma mansoni, lung stage


Date: 21:42:48 on Fri 17 Nov 117.