EST 764158 is a singleton


Sequence

>764158 (1 EST) Length=335 AGTCTTACGATATCATTGACTGGTATAGCTACAATGTCTCAAACTGATATCAACAGTTACAATTCTCTCTCCAGATGTAC TGTCGTGGGCTTTTGTGGTTGTCTTCAAACAAACATAATACCGCTAAAATCCAAGTACGAAATATGTAGAAACTGCCATG ATAGTTGTTTAACTTTCGACGTCACCAGCGGTTCAACGTTGAACGAAATCCTTTTGCTTCATGACTTGTAGTTCTTTGCT ATACGGTTAAGGAATGTAATTGNTATGTGACTACTCTGTGCGACTTTTGCGACTAATCAGCAGGACATTTTGATGTCTCG ATTTTGGGTGTTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764158: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641581685474AA125722MLLG0156.M1FSchistosoma mansoni, lung stage


Date: 3:44:52 on Sat 18 Nov 117.