EST 764159 is a singleton


Sequence

>764159 (1 EST) Length=232 AGACACCGGCATGTATTTTTTGTACAACTTATATAATACCGATTCTATTTGCAACATCTAAAGCGTCAAAATCAGGAGGT AGCTTCACATATGCTTTTTTAACATTGTTAGGGCAATTAAGCGTGTTGACTTTCCGCAACTTTGATATTATAAAAGTTTC TTGGACAGCTGCCTTGATTGCTGGTTTGTTTGGCTCTTCGGTCAACAATGAACCACTTACTGTGTCGTTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764159: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641591685475AA125723MLLG0157.M1FSchistosoma mansoni, lung stage


Date: 9:16:20 on Sat 18 Nov 117.