EST 764162 is a singleton


Sequence

>764162 (1 EST) Length=378 GAGTGTAACAATATTTGTATTAGCTTTTAATCAATGGGGAGAGTACGAAAGAATACGAAGAATACAATTTCTACTTGGGT TCTATGTGAGTAAGATGAGGAACTGTCTGCTGAAAATCCAGCCAGGCCAGAACTACCACCTGCAGCCCTAGGACCAAGCA TCATTGCACGTTGTTGTACTGCTTCTTGCTCTTCAGTTTGAACTCGTTCTAGCTCCAAAATAAGTGGGAGGAAACATATG GTAGTTGTGCTCACTAAAAACCAAGTCACTGATCTGCTGAGAGAATAGCCCTATACAATGCCTTCTGAGGCTGCACTGTA GGCAGAAGAAATACCGCGACGTACTGGCTCTGGAAACATTTCTAAGNGACCAATCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641621685478AA125726MLLG0168.M1FSchistosoma mansoni, lung stage


Date: 17:13:49 on Wed 22 Nov 117.