EST 764164 is a singleton


Sequence

>764164 (1 EST) Length=310 GAGCGCAATCAGAATTGCCTGGGGTTTTTGTGCCAGATAGGGAATATGCACCACCCAGTAGGTCCACGCGGCGAGATAAG CCAGTCCGGGTCCCATCGTGTGTTTAATCCAGGTACTGACCCCGCCCTTCCCATCTTTGAAGGTCGAGCCTAACTGACCA ACAATTAGCGCATAAGGTGTGAAATAGAGTGCAAAGATAAACACCCATGAAAAAACAACCACCAGCCCCTGGTTGGCATA GTTATTAACAACGTTGCCAAAACCCCAGACAGTGATAAAAGACATCAGCGCAATGTTGTACCATCGCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641641685480AA125728MLLG0172.M1FSchistosoma mansoni, lung stage


Date: 4:43:44 on Sat 25 Nov 117.