EST 764167 is a singleton


Sequence

>764167 (1 EST) Length=273 CGTTTATTACAGTATTATTTTCAATGAAAAACAGAATGAAATTAAAGTATCAATGAATTGTAAAAATCTTAAAAAAGTAA TAGTTCTCGGTTATAAATTACAAAATAATACCCATGCTTAATATATGGATGAATCCAAAAAAACATAGAAAGCAAGCNAA AAAGAAAATACAATTGATTTGCGTAGATTTTAATGTTTGCCCAGTTTCACTTCATCTTAACTCTGAAGAAACAAGNAAGN GTTACGACTATCACAGNTAACATATGATGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764167: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641671685483AA125731MLLG0176.M1FSchistosoma mansoni, lung stage


Date: 10:42:43 on Mon 20 Nov 117.