EST 764178 is a singleton


Sequence

>764178 (1 EST) Length=243 AAAAGATAAATAACATTGTATTTAGTGAACACATACGAAAATTCAATCAATAAAAAAAACAGTATACAATATGCAAATTA GTTACGGTACAATAACACACTAATGTTCTACAACATTAGCTCTCATAACTGCTATAGAGTTAATTATACATAAAAACTAA TACCGTAAATTATTTAGTTGAAAAAGTTTAATGCCTAAGTTTTTTGATAATCATCAAATGAGTTGATAAAGATTTACAAT AAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764178: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641781685494AA125675MLLG0227.M1FSchistosoma mansoni, lung stage


Date: 20:9:0 on Sat 18 Nov 117.