EST 764186 is a singleton


Sequence

>764186 (1 EST) Length=325 TCTGGTCATTTTCTTATGTGGCAATCGTCATTTCACTCATACCCGCGGCGTTAACAAAAAAGTACTGCGTGCGACAAACT TTCTCCTGCCGAACTGGGGATGGCTGCTGGTTCTGCTGGTTGGCAACGCCTGCACTGATTACCATACTGTTCTGGAAAGA GTGGTCGGTATACGCCTTAATTGTCGCGACTATTATTGGCCTGGGTGTACTGGCAAAAATTTATCGCAAAGCAGAAAACC AGAAACAGCGGAAGGAGCTGGGGCTGATTGTGACGCTCACCTTCTTCAGTATGTTGGTTCTCGGGCCTTCGCACAACAGG GCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764186: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641861685502AA125683MLLG0239.M1FSchistosoma mansoni, lung stage


Date: 1:32:4 on Sun 19 Nov 117.